Human CHD2 (long isoform) Difficult PCR Amplification
PCR Success Story #5Project Description
Difficult PCR Amplification of CHD2 (long isoform) from human cDNA
This project looked pretty simple but it ended up being a HUGE challenge and very Difficult PCR to achieve. The constraits were caused by primer design and the target’s sequence. The customer mentionned that all other high-fidelity DNA polymerases failed at amplifying full lenght CHD2 long isoform from human lymphocyte cDNA, The researcher provided us with PCR primers and cDNA.
Difficult PCR Challenges: Very long forward primer, very low GC content of the gene-specific target annealing sites and no 3′ end GC-clamp. The sequences in bold letters are gene-specific:
CHD2 long isoform (5222 kb with extensions)
- Forward: CCGGATCCGCCACCATGGAACAAAAACTCATCTCAGAAGAGGATCTGATGAGAAATAAGGACAAAAGCCAA (71-mer; gene-specific is 35% GC and Tm = 55°C)
- Reverse: CGCGAATTCTTATGTTTTCCGAACATTCCAGTT (gene-specific is 33% GC and Tm = 52°C)
Project Details
Client: CR-CHUM
Date: April 25th, 2016
Type of experiment: High-Fidelity amplification from cDNA
DNA Polymerases: TransStart FastPfu and KD Plus
Competitors: None
Amplification of CHD2
This was the most challenging PCR we ever attempted. Nevertheless, we successfully amplified full-lenght long isoform of human CHD2 using TransStart FastPfu and KD Plus. The amplified fragment was confirmed by sequencing.
PCR reaction setup:
- H2O : 12.4 ul
- 5x buffer : 4 ul
- dNTPs (2.5mM): 1.6 ul (0.2 mM final)
- F1 (10 uM): 0.4 ul (200 nM final)
- F2 (10 uM): 0.4 ul
- cDNA : 0.8 ul human cDNA
- Pol (2.5 u/ul for FastPfu; 1u/ul for KD Plus) : 0.4 ul
PCR cycling :
- Denaturation: 120s at 95 °C
- 30 x
- Denaturation: 20s at 95 °C
- Annealing: 20s at 53 °C
- Extension: 70s at 68 °C
- Final extension: 200s at 68 °C
