1-877-661-4711 info@civicbio.com
Select Page

PCR Success Story #17: High-Fidelity PCR Amplification of repetitive sequences and PCR Overlap Assembly of 3 Fragments

PCR Success Story #17

Project Description

High-Fidelity PCR Amplification of repetitive sequences and PCR Overlap Assembly of 3 Fragments

This project originated from a customer referral who learned about our problem-solving abilities. The researcher’s lab is located at the Centre de Recherche du Centre Hospitalier de l’Université Laval (CR-CHUL) in Québec city. They challenged us to amplify DNA sequences from confidential genomic DNA and from DNA plasmids containing other sequences of interest. Their goal was to assemble these 3 fragments by PCR overlap extension.

They tried to perform this using Phusion DNA Polymerase but were unsuccessful in the steps detailed below:

  • The first challenge was to obtain specific bands by high-fidelity PCR.
  • Then, assemble everything together by PCR overlap and extension.

Note: we had to redesign some of their primers because one of them had 2 binding sites, thus the PCR amplification could not be specific.

Project Details

Client: Université Laval
Date: August 4th, 2016
Type of experiment: High-Fidelity PCR and PCR overlap and extension
DNA Polymerase: TransStart FastPfu (High-Fidelity) DNA Polymerase & KD Plus

Competitor: Phusion® High-Fidelity DNA Polymerase (NEB version)

Phusion® is a trademark of ThermoFisher Scientific

3-fragment-PCR-overlap-design

Desired DNA Fragment Assembly Design

So the goal and strategy of the design for PCR overlap and extension is depicted in this image. We have to produce 3 DNA fragments by high-fidelity PCR and join them together by high-fidelity PCR forward primer A and reverse primer F.

Problem: primer C has 2 binding sites…

Original primer C :

TTCTCCTTCCCCTCTCTCTC

5′ end of MIDDLE fragment (primer C binding sites in bold and underlined):

CATCCCGTTCTCCTTCCCCTCTCTCTCCTCTCTCCTCTCTCCAGGAGTTCTCTCATCTCCTTCCCCTCTCTCTCCTCTCTCCTCTCTCCAGAG

A second binding site was identified for primer C containing a single mismatch in its extreme 5′ (A). Therefore we redesigned this primer to: GTTCTCCTTCCCCTCTCTCTCCTCTCTCCTCTCTCCAGGAG

PCR amplification of AB, CD and EF fragments

The AB fragment was amplified using TransStart KD Plus (Ultra-HiFi) DNA Polymerase.

CD and EF fragment were amplified by PCR using TransStart FastPfu (High-Fielity) DNA Polymerase.

The arrows point to the specific amplicons that were then extracted ad purified using the Favorprep GEL/PCR Purification Kit.

Contact us for your design!
PCR amplification of AB, CD and EF
PCR overlap and assembly of 3 fragments

Successful PCR Overlap Assembly with FastPfu

1 ul of purified LEFT, MIDDLE and RIGHT fragments were mixed with primer A and F in a standard FastPfu PCR reaction. The correct amplicon corresponding to the full assembly of LEFT-MIDDLE-RIGHT is shown by the arrow, along with the corresponding fragments. Likely due to the nature of fragment LEFT and MIDDLE fragments to multimerize, we can also see some non-desired bands above the fully assembled amplicon.

 

SUCCESS !

Assemble with FastPfu
Available Products for High-Fidelity PCR

Want PCR to be easier for you too?

Put us in charge of optimizing PCR conditions for you. It’s FREE !
Contact us to use our FREE service