High-Fidelity and Specific PCR from human gDNA
PCR Success Story #9Project Description
Specific PCR with High-Fidelity DNA Polymerases
This project was quite important to solve. We met with a researcher located at the Centre de Recherche du CHU Ste-Justine who had the following problem. The lab extracts and purifies genomic DNA from patients blood and need to amplify human genes with high-fidelity and high specificity. Then, they sequence the PCR product in order to find rare mutations. Their freezer was loaded with both NEB and Thermo’s Phusion® High-Fidelity DNA Polymerase yet, PCR amplification results were poor. They contained many wrong-sized bands which affected greatly the subsequent DNA sequencing results. Achieving Specific PCR amplification was a must for them. The researcher provided us with their primers for hSSPO and their purified human gDNA. Please find below first-attempt results obtained using Transgen Biotech’s TransStart FastPfu FLY (Ultra-HiFi) DNA polymerase and other DNA polymerases.
hSSPO forward primer: TGATCTGTCTTCCTGCCACA
hSSPO reverse primer: CCTTGACCAGGTCCATGACT
Phusion® is a trademark of ThermoFisher Scientific.
Project Details
Client: CR-CHU Ste-Justine
Date: May 25th, 2016
Type of experiment: Human gDNA high-fidelity amplification by PCR
DNA Polymerase: TransStart FastPfu FLY (Ultra-HiFi) DNA Polymerase.
Competitor: Thermo Phusion® HotStart II High-Fidelity DNA Polymerase
Specific PCR amplification of hSSPO from gDNA with FastPfu FLY
Amplification of a segment of hSSPO from purifed gDNA DNA samples from two researchers located in two different institutes. Human MC2R was also amplified as a control using TransStart FastPfu High-Fidelity DNA Polymerase. Although the results for hSSPO using FastPfu were almost tolerable, TransStart FastPfu FLY (Ultra-HiFi) DNA polymerase amplified hSSPO perfectly in contrast to Phusion® HotStart II High-Fidelity DNA Polymerase. The researcher also performed the same experiment in his lab using sample-size of FastPfu FLY and also achieved perfect amplification of hSSPO. Even if the researcher’s freezer was loaded with more than 1000$ worth of the Phusion®, we received an order for FastPfu FLY on the next day :-). In addition to getting better future results, the researcher now also benefits from a DNA Polymerase offering twice the fidelity than Phusion®.
PCR reaction setup:
- H2O : 12.2 ul
- 10x buffer : 4 ul
- dNTPs (2.5 mM): 1.6 ul (0.2 mM final)
- Forward primer (25 uM): 0.16 ul (200 nM final)
- Reverse primer (25 uM) : 0.16 ul (200 nM final)
- gDNA 10 ng/ul : 1 ul
- Polymerase (2.5 u/ul) : 0.4 ul
PCR cycling :
- Denaturation: 60s at 94 °C
- 35 x
- Denaturation: 15s at 94 °C
- Annealing: 20s at 57 °C
- Extension: 10s at 72 °C
- Final extension: 60s at 72 °C
Want perfect PCR too?
Put us in charge of optimizing PCR conditions for you. It’s FREE !