Fast & Steep PCR Protocol
Fast PCR Protocol for Cloning and Site-Directed MutagenesisFast & Steep PCR can be used for quick DNA amplification from plasmid DNA, purified DNA fragments and assembly PCR by extension of overlapping DNA fragments.
DNA Amplification by PCR is Exponential
Polymerase chain reaction, PCR, is a technique to make many copies of a specific DNA region in vitro. PCR relies on a thermostable DNA polymerase and requires DNA oligonucleotides, known as DNA primers, that are specific for the DNA region of interest. In PCR, the reaction is repeatedly cycled through a series of temperature changes, which allows many copies of the target region to be produced. PCR has many research and practical applications and has been used for a few decades now. It is routinely used in DNA cloning, medical diagnostics, and forensic analysis of DNA.
Under optimal conditions (i.e., if there are no limitations due to limiting substrates or reagents), at each extension/elongation step, the number of target DNA molecules is doubled. With each successive cycle, the original template strands plus all newly generated strands become templates for the next round of amplification, leading to exponential amplification of the target DNA of interest. The processes of denaturation, annealing and elongation constitute a single cycle. Multiple cycles are required to amplify the DNA target to millions of copies. The formula used to calculate the number of DNA copies formed after a given number of cycles is 2n, where n is the number of cycles. Thus, a reaction set for 30 cycles results in 230, or 1073741824, copies of the original double-stranded DNA target region.
A typical PCR reaction is divided into 3 steps and the second step is divided also into 3 steps.
- Initial denaturation at 94-98 °C for 30s to 300s
- Repeated Amplification
- Denaturation at 94-98 °C for 5s to 30s
- Annealing at Ta °C for 5s to 30s
- Extension at 66-75 °C for 30/60s per kb
- Final Extension at 66-75 °C for 120s to 600s
The basis behind the Fast & Steep PCR protocol
The idea behind our Fast & Steep PCR protocol, used for performing PCR on plasmid of fragment DNA, is to take advantage of the exponential growth of DNA molecules during PCR. Typically, a minute amount of DNA template is added into a PCR reaction and 25 to 35 cycles are used to reach the plateau of the exponential DNA amplification curve. The main reason why only a small amount of DNA template (i.e genomic DNA) is added to the reaction is that at high concentration, DNA inhibits DNA polymerases - it’s also one reason why DNA amplification by PCR reaches to a plateau.
Fast & Steep PCR takes advantage of the exponential growth rate of DNA amplification by PCR.
When performing PCR on a simple template DNA such as a plasmid or a DNA fragment the relative ratio of ‘junk DNA’ to target DNA is very low. Thus, this represents an opportunity to increase the amount of input DNA mixed into the PCR reaction. This shifts the reaction directly into the linear exponential growth part of PCR. Hence, it enables you to reduce the number of PCR cycles to a minimum before the reaction reaches the plateau.
The Fast & Steep PCR protocol will give you this
Standard PCR Protocol
Standard PCR reaction setup
ddH2O : to 50 ul
5x buffer: 10 ul
dNTPs (2,5 mM) : 4 ul
F primer (10 uM) : 1 ul (0,2 uM) )(10 pmol)
R primer (10 uM) : 1 ul (0,2 uM) )(10 pmol)
DNA (plasmid or fragment): 1 pg to 50 ng
FastPfu FLY : 1 ul (2.5 u)
Standard PCR Cycling
1-5 min denaturation at 95°C
25-35x:
15-30s denaturation at 95°C
10-30s annealing at optimal Ta
10-30s/kb (2-6 kb/min) at 72°C
2-10 min final extension at 72°C
Fast & Steep PCR Protocol
Fast & Steep PCR reaction setup
ddH2O : to 50 ul
5x buffer: 10 ul
dNTPs (2,5 mM) : 4 ul
F primer (10 uM) : 2 ul (0,4 uM)(20 pmol***)
R primer (10 uM) : 2 ul (0,4 uM)(20 pmol***)
DNA (plasmid or fragment): 100 ng to 1 ug (0,25 to 0,5 pmol***)
FastPfu FLY : 1 ul (2.5 u)
Fast & Steep PCR Cycling
2-5 min denaturation at 95°C
5-10x :
20s denaturation at 95°C
30s annealing at Ta of highest primer Tm
30-60s/kb (1-2 kb/min) at 68°C
5 min final extension at 68°C
Advantages of using the Fast & Steep PCR Protocol
Very Fast PCR Protocol
- 15-45 min for 300 bp and 10 kb respectively.
- PCR cycling time varies depending on template lenght and ramping rates.
Efficient DNA amplification
- Incorporates up to 100% of primers in a very short amount of time.
- GC content and primer specificity may affect the efficiency.
Non-Ambiguious PCR Results
- PCR amplicons have fully incorporated your primers.
- When performing site-directed mutagenesis, so far, our success rate is 100%.
Low error rate / High-Fidelity PCR
- 5 to 10 PCR cycles is sufficient.
- Limit the chance of introducing errors by limiting the amount of doublings and heating cycles, without compromising the DNA yield.
Using the fewest number of PCR cycles helps to avoid DNA depurination and deamination
Depurination
⇒ Depurination involves the loss of purine bases forming abasic sites.
⇒ Depurination decreases at higher pH.
⇒ Depurination is independent of DNA sequence.
⇒ Heating DNA for 10 minutes at 100°C with pH 7.0 leads to about 1 apurinic site per 1000 base pairs.
Deamination
⇒ Cytosine can be spontaneously deaminated to form uracil.
⇒ Cytosine in native DNA is estimated to deanimate with a rate constant of 10-10/sec at 70°C.
Reason #1
After initially having performed RT-PCR for human CHD2 long isoform in PCR Success Story #5, we needed to clone the *** gene into an expression vector. This particuliar gene has a very strong tendency to recombine and was difficult to amplify. The DNA sequenc for the myc tag also created problems. Hence, we wanted to substitute it for an HA tag using the fewest PCR cycles possible.
Our first Fast & Steep PCR was asymetric in the sense that we favored annealing of the forward primer to make sure the myc tag was replaced by the HA tag sequence.
Our very first Fast & Steep PCR
Our first ever attempt at using a very short PCR cycling run was to replace a myc tag by a HA tag on the full-lenght CHD2 long isoform DNA sequence using KD Plus High-Fidelity DNA Polymerase. Three different full lenght CHD2 DNA templates were used. The input volume of CHD2 was 10 ul out of a total reaction volume of 30 ul. Left: 2 ul of each DNA input were loaded on the gel representing one fifth of the real input. Right: 6 ul of post-PCR reactions were loaded on the gel, representing one fifth on the total reaction volume. In light of these results, 5 PCR cycles were sufficient to amplify the target DNA and add the HA tag DNA sequence.
Reason #2
Before we succeeded with PCR Success Story #16, we partially were unsuccessful when performing site-directed mutagenesis by other methods such as by using the Fast Mutagenesis PCR protocol or the KLD-assisted back-to-back primer design protocol. Partially unsuccessful means that it worked, but we also sequenced wild-type clones…AND WE HATE SEQUENCING WILD-TYPES! Don’t you?
Reason #3
Fast & Steep PCR is time and cost efficent by enabling to perform 3 successive additions of 5’ end extensions to a DNA template…in approximately 2 hours, including 3 purification steps.
Triple primer extension using Fast & Steep PCR
Agarose gel electrophoresis of triple primer extension performed using the Fast & Steep protocol. Left: 1.25 ul of the starting DNA input (lane 1) and of the purified DNAs used for input into the first, second and third PCR reaction (lane 2, 3 and 4 respectively). The data shows an expected increase in DNA size from 334 to 357, 384 and 405 bp and an increase of DNA stain intensity. No trace of the initial input DNA is observed. Right: As a mean to illustrate the efficiency or each primer extension run, volume increments proportional to the dilution factor of the initial DNA input were loaded side-by-side. Remarquably, no unused primers and no trace of the initial input (lane #5) can be observed in either lane 6, 7 or 8, demonstrating the very high efficiency of Fast & Steep PCR on short DNA fragments.
DNA input and DNA Polymerases used in Fast & Steep PCR
Determination of the Optimal DNA input
Fast & Steep PCR with FastPfu FLY
A gradient of DNA input was used to determine the optimal DNA input of plasmid DNA (total vector size: 6 kb) for amplifying human MC2R by Fast & Steep PCR usng FastPfu FLY Ultra-HiFi DNA Polymerase. 5, 10, 50, 100, 500 and 1000 ng of pcDNA5/FRT/Myc-MC2R is equivalent to 1.35, 2.70, 13.5, 27.0, 135.0 and 270.0 femtomoles respectively. The target DNA represents 15% of the total DNA input (0.2, 0.4, 2.0, 4.1, 20.0 and 40.5 fmol respectively). The optimal DNA input appeared to be 500 ng in a 25 ul reaction for this template and vector.
Fast & Steep PCR with FastPfu
A gradient of DNA input was used to determine the optimal DNA input of plasmid DNA (total vector size: 6 kb) for amplifying human MC2R by Fast & Steep PCR usng FastPfu High-Fidelity DNA Polymerase. 5, 10, 50, 100, 500 and 1000 ng of pcDNA5/FRT/Myc-MC2R is equivalent to 1.35, 2.70, 13.5, 27.0, 135.0 and 270.0 femtomoles respectively. The target DNA represents 15% of the total DNA input (0.2, 0.4, 2.0, 4.1, 20.0 and 40.5 fmol respectively). Similarly to results obtaine with FastPfu FLY, the optimal DNA input appeared to be 500 ng in a 25 ul reaction for this template and vector.
Tip on Primer Design for Efficient DNA Amplification by PCR
Use a Dedicated Design Software
Never work in a text editor such as Microsoft Word. We recommend using the Snapgene software. A free Snapgene Viewer version is available here.
GC-clamp
Does a sprint runner start its race on its back foot? No! In order to start its race, a sprint runner puts most of his weight on his front foot in order to create strong friction with the ground and get a powerful start to the finish line.
DNA Polymerases also require to grip the DNA template tightly for initiating 5′ to 3′ polymerization. Using a GC-clamp at the 3′ end helps to create this tight grip on single-stranded DNA strand to initiate elongation.
A good GC-clamp consists in ending the 3′ end of the DNA primer with 1 or 2 ‘G’ or ‘C’ (in bold below).
i.e: TCTCTTTCCTACAGCTCCTGG
The 7-base rule
Primer specificity will greatly help to DNA amplification efficiency by PCR. In order to maximize the specificity of your DNA primers, search your entire template DNA for the 7 bases present at the 3′ end of your DNA primer. The goal is to obtain a single match throughout your template sequence. If you find more than 1 match, move your primer elsewhere in your sequence until you only get 1 match.
What can I Achieve by using Fast & Steep PCR ?
Assemble Overlapping DNA Fragments? Sure!
